View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6371_high_3 (Length: 243)

Name: NF6371_high_3
Description: NF6371
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6371_high_3
NF6371_high_3
[»] chr5 (1 HSPs)
chr5 (20-224)||(32789575-32789779)
[»] chr3 (1 HSPs)
chr3 (20-220)||(29103039-29103239)


Alignment Details
Target: chr5 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 20 - 224
Target Start/End: Complemental strand, 32789779 - 32789575
Alignment:
20 gaagtacccgaatggatctagaacgaatcgtgcaaccaaatctggatattggaaggcaactgggaaggatcgaaaggtgaattctcaagctcgagcagta 119  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32789779 gaagtacccgaatggatctagaacgaatcgtgcaaccaaatctggatattggaaggcaactgggaaggatcgaaaggtgaattctcaagctcgagcagta 32789680  T
120 ggggtgaagaaaaccctagtttactatcgaggaagagcaccccatggctctcgtacaaattgggttatgcatgaatatcgacttgatgagagggaatgtg 219  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32789679 ggggtgaagaaaaccctagtttactatcgaggaagagcaccccatggctctcgtacaaattgggttatgcatgaatatcgacttgatgagagggaatgtg 32789580  T
220 aaacc 224  Q
    |||||    
32789579 aaacc 32789575  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 85; Significance: 1e-40; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 20 - 220
Target Start/End: Original strand, 29103039 - 29103239
Alignment:
20 gaagtacccgaatggatctagaacgaatcgtgcaaccaaatctggatattggaaggcaactgggaaggatcgaaaggtgaattctcaagctcgagcagta 119  Q
    |||||| || |||||||| ||||| ||| | ||||| ||||||||||||||||||||||| ||||| ||||| ||||||||| ||||  |||| || ||     
29103039 gaagtatccaaatggatcaagaaccaatagagcaacaaaatctggatattggaaggcaacggggaaagatcgcaaggtgaatgctcagactcgcgccgtt 29103138  T
120 ggggtgaagaaaaccctagtttactatcgaggaagagcaccccatggctctcgtacaaattgggttatgcatgaatatcgacttgatgagagggaatgtg 219  Q
    ||  ||||||||||||||||||||||| ||||||||||||| ||||| ||||| ||   ||||||||||||||| ||||| |||||||| || |||||||    
29103139 ggaatgaagaaaaccctagtttactatagaggaagagcaccacatggatctcgcactggttgggttatgcatgagtatcgtcttgatgaaagagaatgtg 29103238  T
220 a 220  Q
    |    
29103239 a 29103239  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University