View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6372_low_10 (Length: 233)
Name: NF6372_low_10
Description: NF6372
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6372_low_10 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 13 - 233
Target Start/End: Complemental strand, 2320874 - 2320654
Alignment:
| Q |
13 |
attaacacttcgacaatacttgattttgcggttaagcacgagtacattgtacattgttccgctctttttagactctacgttgttctaacttctaaaccaa |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2320874 |
attaacacttcgacaatacttgattttgcggttaagcacgagtacattgtacattgttccgctctttttagactctacgttgttctaacttctaaaccaa |
2320775 |
T |
 |
| Q |
113 |
acaattggcttaaatgctttaataagttacatctaaagacaaattatttgagaaaattcaagtctgattttttatggaacaattattagttaggctgtac |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
2320774 |
acaattggcttaaatgctttaataagttacatctaaagacaaattatttgagaaaattcaagtttgattttttatggaacaattattagttaggctgtac |
2320675 |
T |
 |
| Q |
213 |
ttatttagaccccgttgtcct |
233 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
2320674 |
ttatttagaccccgttgtcct |
2320654 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University