View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6372_low_4 (Length: 383)
Name: NF6372_low_4
Description: NF6372
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6372_low_4 |
 | |
|
| [»] scaffold0088 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0088 (Bit Score: 252; Significance: 1e-140; HSPs: 1)
Name: scaffold0088
Description:
Target: scaffold0088; HSP #1
Raw Score: 252; E-Value: 1e-140
Query Start/End: Original strand, 42 - 366
Target Start/End: Complemental strand, 47473 - 47149
Alignment:
| Q |
42 |
gaagggaggttacatgaagcttagttacgatgaaatcacccatatnnnnnnngataggattcattttgagaccctttatcgttataaatatgtcgatgat |
141 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47473 |
gaagggaggttacatgaagcttagttacgatgaaatcacccatataaaaaaagataggattcattttgagaccctttatcgttataaatatgtcgatgat |
47374 |
T |
|
| Q |
142 |
acattagatagagaagataactgaccgtaatctttgcttttactcgaagatattcaagtgatgcctctatcacactcttttgaccagattttaacaaatc |
241 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||| ||||||||||| |||||||||||||||||| || |
|
|
| T |
47373 |
tcattagatagagaagataacagaccgtaatctttgcttttacttgaagatattcaagtgatgcctttatcacactctcttgaccagattttaacaattc |
47274 |
T |
|
| Q |
242 |
cgttgctgtttcgagcatttcgtatctttgttgtggtgcaccggacatcatcttctgaataaaaacaacaaaactacaatgatcatttatatagaggcca |
341 |
Q |
| |
|
||||| | ||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47273 |
cgttgttttttcgagcaaatcgtatctttgttgtggtgcagcggacatcatcttctgaataaaaacaacaaaactacaatgatcatttatatagaggcca |
47174 |
T |
|
| Q |
342 |
aaggcattaattctctccttttact |
366 |
Q |
| |
|
||| ||||||||||||| ||||||| |
|
|
| T |
47173 |
aagacattaattctctctttttact |
47149 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University