View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6373_high_22 (Length: 294)

Name: NF6373_high_22
Description: NF6373
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6373_high_22
NF6373_high_22
[»] chr5 (1 HSPs)
chr5 (152-203)||(3578389-3578440)


Alignment Details
Target: chr5 (Bit Score: 52; Significance: 7e-21; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 152 - 203
Target Start/End: Complemental strand, 3578440 - 3578389
Alignment:
152 ttttaattatttgtgtcatttctatcactttacttcaaaaacacaacagacg 203  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||    
3578440 ttttaattatttgtgtcatttctatcactttacttcaaaaacacaacagacg 3578389  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University