View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6373_high_39 (Length: 211)
Name: NF6373_high_39
Description: NF6373
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6373_high_39 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 128; Significance: 2e-66; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 128; E-Value: 2e-66
Query Start/End: Original strand, 18 - 196
Target Start/End: Complemental strand, 14824671 - 14824504
Alignment:
| Q |
18 |
gacggaaaattaacgatcaaataatttgttgatcgatattatgcatgagttgaatttaacgacatacgtgaaaattgattaataatgattaatgaaacaa |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
14824671 |
gacggaaaattaacgatcaaataatttgttgatcgatattatgcatgagttgaatttaacgacatacgtgaaaattgat----------taatgaaacaa |
14824582 |
T |
 |
| Q |
118 |
agacaagagaagagtgaagatgaatcaatcaatatataaaatttgtgacctgaattggaggtgattataagtataaact |
196 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||| |
|
|
| T |
14824581 |
agacaagagaagactgaagatgaatcaatcaatatataaaatttgtgacgtgaatt-gaggtgattataagtataaact |
14824504 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University