View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6373_low_28 (Length: 275)
Name: NF6373_low_28
Description: NF6373
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6373_low_28 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 36 - 256
Target Start/End: Original strand, 26865620 - 26865839
Alignment:
| Q |
36 |
aaatataataatacctctataatgcaggacgaaggaactatttggactaaatcgttaaaattcggcctaatgtaggcagtggacccaatggaggccgaaa |
135 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||| ||| |
|
|
| T |
26865620 |
aaatataataatacctctataatgcaggacgaaggaactatttgaactaaatcgttaaaattcggcctaatgtag-cagtggacccaatggaggccaaaa |
26865718 |
T |
 |
| Q |
136 |
ccacaaggaccccaacgcacaaagaaggctccaagctggctcaaggattgcatcttatgttgttgctgtcacgaaaatcttggtcatcaccatttcattg |
235 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
26865719 |
ccacaaggaccccaacgcacaaagaaggctccaagctggctcaaggattgcatcttatgttgttgctgtcacgaaaatcctggtcatcaccatttcattg |
26865818 |
T |
 |
| Q |
236 |
ttaaaattttgttgtgatttc |
256 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
26865819 |
ttaaaattttgttgtgatttc |
26865839 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University