View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6373_low_32 (Length: 264)

Name: NF6373_low_32
Description: NF6373
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6373_low_32
NF6373_low_32
[»] chr8 (1 HSPs)
chr8 (10-198)||(4396226-4396414)


Alignment Details
Target: chr8 (Bit Score: 181; Significance: 7e-98; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 181; E-Value: 7e-98
Query Start/End: Original strand, 10 - 198
Target Start/End: Complemental strand, 4396414 - 4396226
Alignment:
10 aataataaattaaaacaatagtttaacttgtgtttttgtcataaatctctggtttccaagggtaaagggttggttctagtaatccagagttcaacggaat 109  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
4396414 aataataaattaaaacaatagtttaacttgtgtttttgtcataaatctctggtttccaagggtaaagggttggttctagtaatccagagttcaacggaat 4396315  T
110 gtaggtaaaatctggcttgaaactctctactcccaatggattcgatcttcaacgaagtttcattaacccctagtgtctatttggttggc 198  Q
    |||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||    
4396314 gtaggtaaaatctggcttcaaactctctactcccaatcgattcgatcttcaacgaagtttcattaacccctagtgtctatttggttggc 4396226  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University