View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6373_low_40 (Length: 221)
Name: NF6373_low_40
Description: NF6373
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6373_low_40 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 17 - 202
Target Start/End: Original strand, 8552145 - 8552330
Alignment:
| Q |
17 |
acagacagacacagtttgcacagtctaattctatgcttttttaatttctctcctttaacggacctgttgcttgccctatttatttttatgcaatttctta |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8552145 |
acagacagacacagtttgcacagtctaattctatgcttttttaatttctctcctttaacggacctgttgcttgccctatttatttttatgcaatttctta |
8552244 |
T |
|
| Q |
117 |
gtcatatccttctgtcatttacacacacataaaatgctcagagatacataaaataaagctgtatctctatctctatactatagcat |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8552245 |
gtcatatccttctgtcatttacacacacataaaatgctcagagatacataaaataaagctgtatctctatctctatactatagcat |
8552330 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University