View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6373_low_41 (Length: 211)

Name: NF6373_low_41
Description: NF6373
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6373_low_41
NF6373_low_41
[»] chr5 (1 HSPs)
chr5 (18-196)||(14824504-14824671)


Alignment Details
Target: chr5 (Bit Score: 128; Significance: 2e-66; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 128; E-Value: 2e-66
Query Start/End: Original strand, 18 - 196
Target Start/End: Complemental strand, 14824671 - 14824504
Alignment:
18 gacggaaaattaacgatcaaataatttgttgatcgatattatgcatgagttgaatttaacgacatacgtgaaaattgattaataatgattaatgaaacaa 117  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||          |||||||||||    
14824671 gacggaaaattaacgatcaaataatttgttgatcgatattatgcatgagttgaatttaacgacatacgtgaaaattgat----------taatgaaacaa 14824582  T
118 agacaagagaagagtgaagatgaatcaatcaatatataaaatttgtgacctgaattggaggtgattataagtataaact 196  Q
    ||||||||||||| ||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||    
14824581 agacaagagaagactgaagatgaatcaatcaatatataaaatttgtgacgtgaatt-gaggtgattataagtataaact 14824504  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University