View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6373_low_6 (Length: 472)
Name: NF6373_low_6
Description: NF6373
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6373_low_6 |
 |  |
|
| [»] scaffold0484 (1 HSPs) |
 |  |  |
|
| [»] scaffold1904 (1 HSPs) |
 |  |  |
|
| [»] scaffold0039 (1 HSPs) |
 |  |  |
|
| [»] scaffold0027 (1 HSPs) |
 |  |  |
|
| [»] scaffold0497 (1 HSPs) |
 |  |  |
|
| [»] scaffold0037 (1 HSPs) |
 |  |  |
|
| [»] scaffold0156 (1 HSPs) |
 |  |  |
|
| [»] scaffold0473 (1 HSPs) |
 |  |  |
|
| [»] scaffold0111 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr4 (Bit Score: 155; Significance: 4e-82; HSPs: 5)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 155; E-Value: 4e-82
Query Start/End: Original strand, 10 - 192
Target Start/End: Original strand, 20867096 - 20867278
Alignment:
| Q |
10 |
aattactacctttttcccttgaatgaatccggatctctgttgtcccttttggttcggttcagattcggttttttgaacggatgttggaagcggctcggtt |
109 |
Q |
| |
|
|||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||| ||||| |
|
|
| T |
20867096 |
aattactaccttttacccttgaatgaatccgattctctgttgtcccttttggttcggttcagattcggttttttgaatggatgttggaaacggcccggtt |
20867195 |
T |
 |
| Q |
110 |
ctgtggaaaacggcgtcgattgttgttgttccgtccggatcggcctttgtgcttcgatgatgcgtggctgaaggtggattctt |
192 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20867196 |
ctgtggaaaacggcgtcgattgttgttgttccgtctggatcggcctttgtgcttcgatgatgcgtggctgaaggtggattctt |
20867278 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 148; E-Value: 6e-78
Query Start/End: Original strand, 14 - 192
Target Start/End: Complemental strand, 772070 - 771891
Alignment:
| Q |
14 |
actacctttttcccttgaatgaatccggatctctgttgtcccttttggttcggttcagattcggtttttt-gaacggatgttggaagcggctcggttctg |
112 |
Q |
| |
|
|||||||||| ||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||| |||| |||||||| |
|
|
| T |
772070 |
actaccttttacccttgaatgaatccggttctctcttgtcccttttggttcggttcagattcggtttttttgaacggatgttggaaacggcccggttctg |
771971 |
T |
 |
| Q |
113 |
tggaaaacggcgtcgattgttgttgttccgtccggatcggcctttgtgcttcgatgatgcgtggctgaaggtggattctt |
192 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
771970 |
tggaaaacggcgtcgattgttgttgttccgtctggatcggcctttgtgcttcgatgatgcgtggctgaaggtggattctt |
771891 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 361 - 462
Target Start/End: Original strand, 47522215 - 47522316
Alignment:
| Q |
361 |
gcaggcttgcttttatagcattagagttgaatagaataaggaaataacttgcagaagttactaccgcgttcccggatttggcaacaaaaaattgacccta |
460 |
Q |
| |
|
||||| ||| |||||||||||||| |||||| |||||||||||| |||||||||| | | |||| ||| | |||||||| ||||||| ||||||||| |
|
|
| T |
47522215 |
gcaggtttgattttatagcattagggttgaaaagaataaggaaacaacttgcagaggcagcaaccgtgttactggatttggaaacaaaagtttgacccta |
47522314 |
T |
 |
| Q |
461 |
tg |
462 |
Q |
| |
|
|| |
|
|
| T |
47522315 |
tg |
47522316 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 371 - 415
Target Start/End: Original strand, 1877348 - 1877392
Alignment:
| Q |
371 |
ttttatagcattagagttgaatagaataaggaaataacttgcaga |
415 |
Q |
| |
|
||||||| |||||| |||||| | ||||||||||||||||||||| |
|
|
| T |
1877348 |
ttttataccattagggttgaagataataaggaaataacttgcaga |
1877392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 371 - 415
Target Start/End: Original strand, 1891463 - 1891507
Alignment:
| Q |
371 |
ttttatagcattagagttgaatagaataaggaaataacttgcaga |
415 |
Q |
| |
|
||||||| |||||| |||||| | ||||||||||||||||||||| |
|
|
| T |
1891463 |
ttttataccattagggttgaagataataaggaaataacttgcaga |
1891507 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 141; Significance: 1e-73; HSPs: 4)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 141; E-Value: 1e-73
Query Start/End: Original strand, 10 - 190
Target Start/End: Complemental strand, 3710661 - 3710481
Alignment:
| Q |
10 |
aattactacctttttcccttgaatgaatccggatctctgttgtcccttttggttcggttcagattcggttttttgaacggatgttggaagcggctcggtt |
109 |
Q |
| |
|
|||||||||||||| || |||||||||||||| |||||| |||||||||||||||||||||||||||||| |||||||||||||||||| ||| ||||| |
|
|
| T |
3710661 |
aattactaccttttacctttgaatgaatccggttctctgctgtcccttttggttcggttcagattcggttctttgaacggatgttggaaacggtccggtt |
3710562 |
T |
 |
| Q |
110 |
ctgtggaaaacggcgtcgattgttgttgttccgtccggatcggcctttgtgcttcgatgatgcgtggctgaaggtggattc |
190 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3710561 |
ctgtggaaaatggcgtcgattgttgttgttccgtctggatcggcctttgtgcttcgatgatgcgtggctgaaggtggattc |
3710481 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 82; E-Value: 2e-38
Query Start/End: Original strand, 361 - 462
Target Start/End: Complemental strand, 3710282 - 3710181
Alignment:
| Q |
361 |
gcaggcttgcttttatagcattagagttgaatagaataaggaaataacttgcagaagttactaccgcgttcccggatttggcaacaaaaaattgacccta |
460 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||| | ||||||||||||||||| ||||||||| |
|
|
| T |
3710282 |
gcaggcttgcttttatagcattagggttgaatagaataaggaaataacttgcagaggttactaccgcgttactggatttggcaacaaaaatttgacccta |
3710183 |
T |
 |
| Q |
461 |
tg |
462 |
Q |
| |
|
|| |
|
|
| T |
3710182 |
tg |
3710181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 361 - 459
Target Start/End: Complemental strand, 39705477 - 39705379
Alignment:
| Q |
361 |
gcaggcttgcttttatagcattagagttgaatagaataaggaaataacttgcagaagttactaccgcgttcccggatttggcaacaaaaaattgaccct |
459 |
Q |
| |
|
||||| |||||||||||||||||| |||| || |||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||| |
|
|
| T |
39705477 |
gcaggtttgcttttatagcattagggttggattgaataaggaaataacttgcagaagttactaccgcgttcccagatttggaaacaaaaaattgaccct |
39705379 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 277 - 332
Target Start/End: Complemental strand, 3710370 - 3710314
Alignment:
| Q |
277 |
atttgatgcaagtttctttgattcggtctttgtatgcagg-ttgcggctacggtttt |
332 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||| |||||| |
|
|
| T |
3710370 |
atttgatgcaagtttctttgattcggtctttgtatgcaggtttgcggctagggtttt |
3710314 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0484 (Bit Score: 77; Significance: 1e-35; HSPs: 1)
Name: scaffold0484
Description:
Target: scaffold0484; HSP #1
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 362 - 462
Target Start/End: Original strand, 11124 - 11224
Alignment:
| Q |
362 |
caggcttgcttttatagcattagagttgaatagaataaggaaataacttgcagaagttactaccgcgttcccggatttggcaacaaaaaattgaccctat |
461 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||| ||||| | ||||||||||||||||| |||||||||| |
|
|
| T |
11124 |
caggcttgcttttatagcattagggttgaatagaataaggaaataacttgcagaggttactactgcgttactggatttggcaacaaaaatttgaccctat |
11223 |
T |
 |
| Q |
462 |
g |
462 |
Q |
| |
|
| |
|
|
| T |
11224 |
g |
11224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 75; Significance: 2e-34; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 361 - 459
Target Start/End: Original strand, 1888522 - 1888620
Alignment:
| Q |
361 |
gcaggcttgcttttatagcattagagttgaatagaataaggaaataacttgcagaagttactaccgcgttcccggatttggcaacaaaaaattgaccct |
459 |
Q |
| |
|
||||| |||||||||||||||||| |||| || |||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||| |
|
|
| T |
1888522 |
gcaggtttgcttttatagcattagggttggattgaataaggaaataacttgcagaagttactaccgcgttcccagatttggaaacaaaaaattgaccct |
1888620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 361 - 459
Target Start/End: Original strand, 1902623 - 1902721
Alignment:
| Q |
361 |
gcaggcttgcttttatagcattagagttgaatagaataaggaaataacttgcagaagttactaccgcgttcccggatttggcaacaaaaaattgaccct |
459 |
Q |
| |
|
||||| |||||||||||||||||| |||| || |||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||| |
|
|
| T |
1902623 |
gcaggtttgcttttatagcattagggttggattgaataaggaaataacttgcagaagttactaccgcgttcccagatttggaaacaaaaaattgaccct |
1902721 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 361 - 459
Target Start/End: Original strand, 24187721 - 24187819
Alignment:
| Q |
361 |
gcaggcttgcttttatagcattagagttgaatagaataaggaaataacttgcagaagttactaccgcgttcccggatttggcaacaaaaaattgaccct |
459 |
Q |
| |
|
||||| |||||||||||||||||| |||| || |||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||| |
|
|
| T |
24187721 |
gcaggtttgcttttatagcattagggttggattgaataaggaaataacttgcagaagttactaccgcgttcccagatttggaaacaaaaaattgaccct |
24187819 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 75; Significance: 2e-34; HSPs: 7)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 361 - 459
Target Start/End: Original strand, 26719339 - 26719437
Alignment:
| Q |
361 |
gcaggcttgcttttatagcattagagttgaatagaataaggaaataacttgcagaagttactaccgcgttcccggatttggcaacaaaaaattgaccct |
459 |
Q |
| |
|
||||| |||||||||||||||||| |||| || |||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||| |
|
|
| T |
26719339 |
gcaggtttgcttttatagcattagggttggattgaataaggaaataacttgcagaagttactaccgcgttcccagatttggaaacaaaaaattgaccct |
26719437 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 361 - 459
Target Start/End: Original strand, 26733427 - 26733525
Alignment:
| Q |
361 |
gcaggcttgcttttatagcattagagttgaatagaataaggaaataacttgcagaagttactaccgcgttcccggatttggcaacaaaaaattgaccct |
459 |
Q |
| |
|
||||| |||||||||||||||||| |||| || |||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||| |
|
|
| T |
26733427 |
gcaggtttgcttttatagcattagggttggattgaataaggaaataacttgcagaagttactaccgcgttcccagatttggaaacaaaaaattgaccct |
26733525 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 64; E-Value: 9e-28
Query Start/End: Original strand, 368 - 462
Target Start/End: Original strand, 34529565 - 34529660
Alignment:
| Q |
368 |
tgcttttatagcattagagttgaatagaataaggaaataacttgcagaagttactaccgcgttcccggatttggcaac-aaaaaattgaccctatg |
462 |
Q |
| |
|
||||||||||| ||||| |||| || ||| |||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
34529565 |
tgcttttatagtattagggttggattgaacaaggaaataactggcagaagttactaccgcgttcccggatttggcaacaaaaaaattgaccctatg |
34529660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 64; E-Value: 9e-28
Query Start/End: Original strand, 368 - 462
Target Start/End: Original strand, 34543538 - 34543633
Alignment:
| Q |
368 |
tgcttttatagcattagagttgaatagaataaggaaataacttgcagaagttactaccgcgttcccggatttggcaac-aaaaaattgaccctatg |
462 |
Q |
| |
|
||||||||||| ||||| |||| || ||| |||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
34543538 |
tgcttttatagtattagggttggattgaacaaggaaataactggcagaagttactaccgcgttcccggatttggcaacaaaaaaattgaccctatg |
34543633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 361 - 462
Target Start/End: Complemental strand, 25484046 - 25483945
Alignment:
| Q |
361 |
gcaggcttgcttttatagcattagagttgaatagaataaggaaataacttgcagaagttactaccgcgttcccggatttggcaacaaaaaattgacccta |
460 |
Q |
| |
|
||||| ||| ||||||| ||||| |||||||| ||||||||||||||||||||| ||||||||||| || | ||||||||||||||||| ||||||||| |
|
|
| T |
25484046 |
gcaggtttgattttatacaattagggttgaataaaataaggaaataacttgcagaggttactaccgcattgctggatttggcaacaaaaacttgacccta |
25483947 |
T |
 |
| Q |
461 |
tg |
462 |
Q |
| |
|
|| |
|
|
| T |
25483946 |
tg |
25483945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 54; E-Value: 8e-22
Query Start/End: Original strand, 361 - 462
Target Start/End: Original strand, 20371927 - 20372028
Alignment:
| Q |
361 |
gcaggcttgcttttatagcattagagttgaatagaataaggaaataacttgcagaagttactaccgcgttcccggatttggcaacaaaaaattgacccta |
460 |
Q |
| |
|
||||| |||||||||||||||||| |||| |||||||||||||||| ||||||||| ||||||| | || | |||||||||||||||| ||||||||| |
|
|
| T |
20371927 |
gcaggtttgcttttatagcattagggttggatagaataaggaaatatcttgcagaaattactactgatttgctggatttggcaacaaaactttgacccta |
20372026 |
T |
 |
| Q |
461 |
tg |
462 |
Q |
| |
|
|| |
|
|
| T |
20372027 |
tg |
20372028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 361 - 462
Target Start/End: Complemental strand, 20621972 - 20621871
Alignment:
| Q |
361 |
gcaggcttgcttttatagcattagagttgaatagaataaggaaataacttgcagaagttactaccgcgttcccggatttggcaacaaaaaattgacccta |
460 |
Q |
| |
|
||||| ||| |||||||||||||| |||||| ||||||||||| ||||||||||| ||| ||| | | | | ||||||||||||||||| ||||||||| |
|
|
| T |
20621972 |
gcaggtttgattttatagcattagggttgaagagaataaggaagtaacttgcagagattattactgagctgctggatttggcaacaaaaacttgacccta |
20621873 |
T |
 |
| Q |
461 |
tg |
462 |
Q |
| |
|
|| |
|
|
| T |
20621872 |
tg |
20621871 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 72; Significance: 1e-32; HSPs: 8)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 361 - 459
Target Start/End: Original strand, 19828167 - 19828266
Alignment:
| Q |
361 |
gcaggcttgcttttatagcattagagttgaatagaataaggaaataacttgcagaagttactaccgcgttcccggatttggcaac-aaaaaattgaccct |
459 |
Q |
| |
|
||||| |||||||||||||||||| |||| || |||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
19828167 |
gcaggtttgcttttatagcattagggttggattgaataaggaaataacttgcagaagttactaccgcgttcccggatttggaaacaaaaaaattgaccct |
19828266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 361 - 459
Target Start/End: Complemental strand, 27535861 - 27535763
Alignment:
| Q |
361 |
gcaggcttgcttttatagcattagagttgaatagaataaggaaataacttgcagaagttactaccgcgttcccggatttggcaacaaaaaattgaccct |
459 |
Q |
| |
|
||||| |||||||||||||||||| |||| || || ||||||||||||||||||||||||||||||| ||||| ||||||| ||||||||||||||||| |
|
|
| T |
27535861 |
gcaggtttgcttttatagcattagggttggattgagtaaggaaataacttgcagaagttactaccgccttcccagatttggaaacaaaaaattgaccct |
27535763 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 361 - 459
Target Start/End: Complemental strand, 27550071 - 27549973
Alignment:
| Q |
361 |
gcaggcttgcttttatagcattagagttgaatagaataaggaaataacttgcagaagttactaccgcgttcccggatttggcaacaaaaaattgaccct |
459 |
Q |
| |
|
||||| |||||||||||||||||| |||| || || ||||||||||||||||||||||||||||||| ||||| ||||||| ||||||||||||||||| |
|
|
| T |
27550071 |
gcaggtttgcttttatagcattagggttggattgagtaaggaaataacttgcagaagttactaccgccttcccagatttggaaacaaaaaattgaccct |
27549973 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 10 - 115
Target Start/End: Complemental strand, 14474437 - 14474333
Alignment:
| Q |
10 |
aattactacctttttcccttgaatgaatccggatctctgttgtcccttttggttcggttcagattcggttttttgaacggatgttggaagcggctcggtt |
109 |
Q |
| |
|
|||||||||||||| || ||||||||| |||| ||||| |||||||| |||||||||||||||||||| | |||||||||||||||||| |||| ||||| |
|
|
| T |
14474437 |
aattactaccttttacctttgaatgaaaccggttctctattgtccctcttggttcggttcagattcgg-tctttgaacggatgttggaaacggcccggtt |
14474339 |
T |
 |
| Q |
110 |
ctgtgg |
115 |
Q |
| |
|
|||||| |
|
|
| T |
14474338 |
ctgtgg |
14474333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 54; E-Value: 8e-22
Query Start/End: Original strand, 361 - 462
Target Start/End: Original strand, 20532287 - 20532388
Alignment:
| Q |
361 |
gcaggcttgcttttatagcattagagttgaatagaataaggaaataacttgcagaagttactaccgcgttcccggatttggcaacaaaaaattgacccta |
460 |
Q |
| |
|
||||| |||||||||||||||||| |||| |||||| |||||||||||||||||| ||||||| | ||| | |||||||||||||||| ||||||||| |
|
|
| T |
20532287 |
gcaggtttgcttttatagcattagggttggatagaacaaggaaataacttgcagagattactactgagttgctggatttggcaacaaaactttgacccta |
20532386 |
T |
 |
| Q |
461 |
tg |
462 |
Q |
| |
|
|| |
|
|
| T |
20532387 |
tg |
20532388 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 279 - 332
Target Start/End: Original strand, 20532155 - 20532208
Alignment:
| Q |
279 |
ttgatgcaagtttctttgattcggtctttgtatgcaggttgcggctacggtttt |
332 |
Q |
| |
|
|||||||| ||||||||||||||||||| | |||||| ||||||||| |||||| |
|
|
| T |
20532155 |
ttgatgcaggtttctttgattcggtcttgggatgcagtttgcggctagggtttt |
20532208 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 361 - 462
Target Start/End: Complemental strand, 25550742 - 25550641
Alignment:
| Q |
361 |
gcaggcttgcttttatagcattagagttgaatagaataaggaaataacttgcagaagttactaccgcgttcccggatttggcaacaaaaaattgacccta |
460 |
Q |
| |
|
||||| ||| |||||||||||||| |||||| |||| ||||||| |||||||||| | | |||| ||| | |||||||| ||||||| ||||||||| |
|
|
| T |
25550742 |
gcaggtttgattttatagcattagggttgaagagaaaaaggaaacaacttgcagaggcagcaaccgtgttactggatttggaaacaaaagtttgacccta |
25550643 |
T |
 |
| Q |
461 |
tg |
462 |
Q |
| |
|
|| |
|
|
| T |
25550642 |
tg |
25550641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 361 - 415
Target Start/End: Complemental strand, 25992309 - 25992255
Alignment:
| Q |
361 |
gcaggcttgcttttatagcattagagttgaatagaataaggaaataacttgcaga |
415 |
Q |
| |
|
||||| ||| |||||||||||||| |||||| |||| ||||||| |||||||||| |
|
|
| T |
25992309 |
gcaggtttgattttatagcattagggttgaagagaaaaaggaaacaacttgcaga |
25992255 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1904 (Bit Score: 71; Significance: 6e-32; HSPs: 1)
Name: scaffold1904
Description:
Target: scaffold1904; HSP #1
Raw Score: 71; E-Value: 6e-32
Query Start/End: Original strand, 10 - 115
Target Start/End: Complemental strand, 434 - 326
Alignment:
| Q |
10 |
aattactacctttttcccttgaatgaatccggatctctgttgtcccttttggttcggttcagattcggtt---ttttgaacggatgttggaagcggctcg |
106 |
Q |
| |
|
|||||||||||||| |||||||||||| |||| ||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||| |||| || |
|
|
| T |
434 |
aattactaccttttacccttgaatgaaaccggttctctattgtcccttttggttcggttcagattcggtttttttttgaacggatgttggaaacggcccg |
335 |
T |
 |
| Q |
107 |
gttctgtgg |
115 |
Q |
| |
|
||||||||| |
|
|
| T |
334 |
gttctgtgg |
326 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0039 (Bit Score: 70; Significance: 2e-31; HSPs: 1)
Name: scaffold0039
Description:
Target: scaffold0039; HSP #1
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 361 - 462
Target Start/End: Original strand, 40459 - 40560
Alignment:
| Q |
361 |
gcaggcttgcttttatagcattagagttgaatagaataaggaaataacttgcagaagttactaccgcgttcccggatttggcaacaaaaaattgacccta |
460 |
Q |
| |
|
||||| ||| ||||||| |||||| |||||||||||||||||||||||||||||| |||||||||||||| | ||||||||||||||||| ||||||||| |
|
|
| T |
40459 |
gcaggtttgattttataccattagggttgaatagaataaggaaataacttgcagaggttactaccgcgttgctggatttggcaacaaaaacttgacccta |
40558 |
T |
 |
| Q |
461 |
tg |
462 |
Q |
| |
|
|| |
|
|
| T |
40559 |
tg |
40560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 64; Significance: 9e-28; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 64; E-Value: 9e-28
Query Start/End: Original strand, 368 - 462
Target Start/End: Complemental strand, 34584830 - 34584735
Alignment:
| Q |
368 |
tgcttttatagcattagagttgaatagaataaggaaataacttgcagaagttactaccgcgttcccggatttggcaacaa-aaaattgaccctatg |
462 |
Q |
| |
|
||||||||||| ||||| |||| || ||| |||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
34584830 |
tgcttttatagtattagggttggattgaacaaggaaataactggcagaagttactaccgcgttcccggatttggcaacaaaaaaattgaccctatg |
34584735 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 371 - 415
Target Start/End: Complemental strand, 28457985 - 28457941
Alignment:
| Q |
371 |
ttttatagcattagagttgaatagaataaggaaataacttgcaga |
415 |
Q |
| |
|
|||||||||||||| |||||| |||| ||||||| |||||||||| |
|
|
| T |
28457985 |
ttttatagcattagggttgaagagaaaaaggaaacaacttgcaga |
28457941 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 278 - 318
Target Start/End: Complemental strand, 45497449 - 45497409
Alignment:
| Q |
278 |
tttgatgcaagtttctttgattcggtctttgtatgcaggtt |
318 |
Q |
| |
|
||||||||| |||||||||||||| ||||||||| |||||| |
|
|
| T |
45497449 |
tttgatgcatgtttctttgattcgatctttgtatacaggtt |
45497409 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 62; Significance: 1e-26; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 361 - 462
Target Start/End: Complemental strand, 19224001 - 19223900
Alignment:
| Q |
361 |
gcaggcttgcttttatagcattagagttgaatagaataaggaaataacttgcagaagttactaccgcgttcccggatttggcaacaaaaaattgacccta |
460 |
Q |
| |
|
||||| ||| ||||||| |||||| |||||||| ||||||||||||||||||||| ||||||||||| || | ||||||||||||||||| ||||||||| |
|
|
| T |
19224001 |
gcaggtttgattttataccattagggttgaataaaataaggaaataacttgcagaggttactaccgcattgctggatttggcaacaaaaacttgacccta |
19223902 |
T |
 |
| Q |
461 |
tg |
462 |
Q |
| |
|
|| |
|
|
| T |
19223901 |
tg |
19223900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 54; Significance: 8e-22; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 54; E-Value: 8e-22
Query Start/End: Original strand, 368 - 437
Target Start/End: Complemental strand, 17527405 - 17527336
Alignment:
| Q |
368 |
tgcttttatagcattagagttgaatagaataaggaaataacttgcagaagttactaccgcgttcccggat |
437 |
Q |
| |
|
|||||||||| |||||| |||||| | ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17527405 |
tgcttttatatcattagggttgaagataataaggaaataacttgcagaagttactaccgcgttcccggat |
17527336 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 371 - 415
Target Start/End: Complemental strand, 16759754 - 16759710
Alignment:
| Q |
371 |
ttttatagcattagagttgaatagaataaggaaataacttgcaga |
415 |
Q |
| |
|
||||||| |||||| |||||| | ||||||||||||||||||||| |
|
|
| T |
16759754 |
ttttataccattagggttgaagataataaggaaataacttgcaga |
16759710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 371 - 415
Target Start/End: Complemental strand, 16773638 - 16773594
Alignment:
| Q |
371 |
ttttatagcattagagttgaatagaataaggaaataacttgcaga |
415 |
Q |
| |
|
||||||| |||||| |||||| | ||||||||||||||||||||| |
|
|
| T |
16773638 |
ttttataccattagggttgaagataataaggaaataacttgcaga |
16773594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0027 (Bit Score: 40; Significance: 0.0000000000002; HSPs: 1)
Name: scaffold0027
Description:
Target: scaffold0027; HSP #1
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 371 - 462
Target Start/End: Original strand, 65347 - 65438
Alignment:
| Q |
371 |
ttttatagcattagagttgaatagaataaggaaataacttgcagaagttactaccgcgttcccggatttggcaacaaaaaattgaccctatg |
462 |
Q |
| |
|
||||||| |||||| ||| || ||| |||| ||||||||||||| ||||||||| ||| | ||||||||||||||||| ||||||||||| |
|
|
| T |
65347 |
ttttataccattagggttaaagggaaaaagggaataacttgcagagtttactaccgtgttgctggatttggcaacaaaaacttgaccctatg |
65438 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0497 (Bit Score: 36; Significance: 0.00000000004; HSPs: 1)
Name: scaffold0497
Description:
Target: scaffold0497; HSP #1
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 361 - 416
Target Start/End: Complemental strand, 11457 - 11402
Alignment:
| Q |
361 |
gcaggcttgcttttatagcattagagttgaatagaataaggaaataacttgcagaa |
416 |
Q |
| |
|
||||| ||| |||||||||||||| |||||| |||| ||||||||||||||||||| |
|
|
| T |
11457 |
gcaggtttgattttatagcattagggttgaagagaaaaaggaaataacttgcagaa |
11402 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0037 (Bit Score: 33; Significance: 0.000000003; HSPs: 1)
Name: scaffold0037
Description:
Target: scaffold0037; HSP #1
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 371 - 415
Target Start/End: Original strand, 78050 - 78094
Alignment:
| Q |
371 |
ttttatagcattagagttgaatagaataaggaaataacttgcaga |
415 |
Q |
| |
|
|||||||||||||| |||||| || |||||||||||||||||||| |
|
|
| T |
78050 |
ttttatagcattagggttgaagagtataaggaaataacttgcaga |
78094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0156 (Bit Score: 32; Significance: 0.00000001; HSPs: 1)
Name: scaffold0156
Description:
Target: scaffold0156; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 361 - 416
Target Start/End: Original strand, 34979 - 35034
Alignment:
| Q |
361 |
gcaggcttgcttttatagcattagagttgaatagaataaggaaataacttgcagaa |
416 |
Q |
| |
|
||||| ||| |||||||||||||| |||||| ||| ||||||||||||||||||| |
|
|
| T |
34979 |
gcaggtttgattttatagcattagggttgaagggaaaaaggaaataacttgcagaa |
35034 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0473 (Bit Score: 30; Significance: 0.0000002; HSPs: 1)
Name: scaffold0473
Description:
Target: scaffold0473; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 371 - 415
Target Start/End: Original strand, 8825 - 8870
Alignment:
| Q |
371 |
ttttatagcattagagttgaatagaataaggaaat-aacttgcaga |
415 |
Q |
| |
|
|||||||||||||| |||||| ||||||||||||| |||||||||| |
|
|
| T |
8825 |
ttttatagcattagggttgaaaagaataaggaaataaacttgcaga |
8870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0111 (Bit Score: 29; Significance: 0.0000007; HSPs: 1)
Name: scaffold0111
Description:
Target: scaffold0111; HSP #1
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 371 - 415
Target Start/End: Complemental strand, 33475 - 33431
Alignment:
| Q |
371 |
ttttatagcattagagttgaatagaataaggaaataacttgcaga |
415 |
Q |
| |
|
|||||||||||||| |||||| |||| ||||||| |||||||||| |
|
|
| T |
33475 |
ttttatagcattagggttgaagagaaaaaggaaacaacttgcaga |
33431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University