View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6375_high_5 (Length: 298)
Name: NF6375_high_5
Description: NF6375
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6375_high_5 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 146; Significance: 6e-77; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 146; E-Value: 6e-77
Query Start/End: Original strand, 20 - 173
Target Start/End: Original strand, 29609297 - 29609450
Alignment:
| Q |
20 |
tttaatccttccgtctgtacgtacatgtatgatacaatttgtttccctttgtgcatgacatcatcattcatgaactttgatcaactgaatgtaattgtaa |
119 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29609297 |
tttaatcctaccgtctgtacgtacatgtatgatacaatttgtttccctttgtgcatgacatcatcattcatgaactttgatcaactgaatgtaattgtaa |
29609396 |
T |
|
| Q |
120 |
gcattcacagtcattttatgagaatgactttaattacatatgtgcattagtttg |
173 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29609397 |
gcattcacagacattttatgagaatgactttaattacatatgtgcattagtttg |
29609450 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 245 - 290
Target Start/End: Original strand, 29609496 - 29609541
Alignment:
| Q |
245 |
tgatctctgacatatgatagtgtaatgtctggtgtccgtgtctgtg |
290 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29609496 |
tgatctctgacatatgatagtgtaatgtctggtgtccgtgtctgtg |
29609541 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University