View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6375_low_4 (Length: 365)
Name: NF6375_low_4
Description: NF6375
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6375_low_4 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 158; Significance: 5e-84; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 158; E-Value: 5e-84
Query Start/End: Original strand, 19 - 225
Target Start/End: Complemental strand, 37105759 - 37105554
Alignment:
| Q |
19 |
ttttttactctctgttatacttatatcactcaaaacgctataataaannnnnnnccctttactttatgttttctctgttatcactcaaaatgctataata |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| | |||||||||||| ||||||||||||||||| |
|
|
| T |
37105759 |
ttttttactctctgttatacttatatcactcaaaacgctataataaatttttttccctttactttatctattctctgttatccctcaaaatgctataata |
37105660 |
T |
 |
| Q |
119 |
aattctttacacagccacgatcatcatttttggtagaaaaatgatatttatagagctattttggaacaactttctatcatatttttattgtgttcttatt |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37105659 |
aattctttacacagccacgatcatcatttttga-agaaaaatgatatttatagagctattttggaacaactttctatcatatttttattgtgttcttatt |
37105561 |
T |
 |
| Q |
219 |
ctctctt |
225 |
Q |
| |
|
|| |||| |
|
|
| T |
37105560 |
ctttctt |
37105554 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 183 - 224
Target Start/End: Complemental strand, 36820143 - 36820102
Alignment:
| Q |
183 |
aacaactttctatcatatttttattgtgttcttattctctct |
224 |
Q |
| |
|
||||||||||||||||| |||||||||||| ||||| ||||| |
|
|
| T |
36820143 |
aacaactttctatcatacttttattgtgtttttattttctct |
36820102 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University