View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6375_low_9 (Length: 225)
Name: NF6375_low_9
Description: NF6375
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6375_low_9 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 102; Significance: 8e-51; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 102; E-Value: 8e-51
Query Start/End: Original strand, 99 - 212
Target Start/End: Complemental strand, 33652528 - 33652415
Alignment:
| Q |
99 |
tattcaatgatatgggaccaattgcatcgccttcgtatgctaattggttatttctaataaattctacaaaaatgtttgatttcgttttaatatcattcat |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33652528 |
tattcaatgatatgggaccaattgcatcgccttcgtatgctaattggttatctctagtaaattctacaaaaatgtttgatttcgttttaatatcattcat |
33652429 |
T |
 |
| Q |
199 |
ggttttaaatgatg |
212 |
Q |
| |
|
|||||||| ||||| |
|
|
| T |
33652428 |
ggttttaactgatg |
33652415 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 58; Significance: 1e-24; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 58; E-Value: 1e-24
Query Start/End: Original strand, 114 - 206
Target Start/End: Complemental strand, 4365576 - 4365483
Alignment:
| Q |
114 |
gaccaattgcatcgccttcgtatgctaattggttatttctaataaattctacaaaaatgtttgatttcgtttta-atatcattcatggttttaa |
206 |
Q |
| |
|
|||||| |||||| |||||||||| ||||||||||| || ||||||||||||| |||||||||||||| ||||| ||||||||||||||||||| |
|
|
| T |
4365576 |
gaccaactgcatctccttcgtatgttaattggttatctccaataaattctacagaaatgtttgatttcattttacatatcattcatggttttaa |
4365483 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University