View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6376_high_11 (Length: 244)
Name: NF6376_high_11
Description: NF6376
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6376_high_11 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 18 - 244
Target Start/End: Complemental strand, 53465063 - 53464838
Alignment:
| Q |
18 |
aatagtgtgtgaatgtgaaacataaaagagttttaattcaactcaactcaactaaactcaagggttcattgttccttgcaagacagaaatagtagaaaaa |
117 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53465063 |
aatagtgtgtgaatgtgaaacataaa-gagttttaattcaactcaactcaactaaactcaagggttcattgttccttgcaagacagaaatagtagaaaaa |
53464965 |
T |
 |
| Q |
118 |
taagggagggacatatatctgcaagatcagtggagatcctaagaggttgtcgccttcattaatggcacagtttggatcctttgtcggtcgatgatcatat |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
53464964 |
taagggagggacatatatctgcaagatcagtggagatcctaagaggttgtcgccttcattaatggcacagtttggatcctttgtcggtcgatgatcaaat |
53464865 |
T |
 |
| Q |
218 |
gaaactaaattaattaaaatatttaat |
244 |
Q |
| |
|
|||||||||||||||||||||| |||| |
|
|
| T |
53464864 |
gaaactaaattaattaaaatatataat |
53464838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University