View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6376_low_10 (Length: 245)
Name: NF6376_low_10
Description: NF6376
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6376_low_10 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 131; Significance: 4e-68; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 131; E-Value: 4e-68
Query Start/End: Original strand, 1 - 224
Target Start/End: Original strand, 32973572 - 32973785
Alignment:
| Q |
1 |
gtgaataaaatatgagaaaaacctaaagacaatccacgtgttaaagcagatatgcgtatcatcgattattcatacagattctacgcagtgtttggcccca |
100 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
32973572 |
gtgaataaaatatgacaaaaacctaaagacaatccacgtgttaaagcagatatgcgtatcatcgattattcatacagattctacgcagtatttggcccca |
32973671 |
T |
 |
| Q |
101 |
caccatattccttgattnnnnnnnnnnnnnnnnnnnngatttgttgtacataataaaatcaaaattaagcttaacaactaacattccatcttcttctccc |
200 |
Q |
| |
|
||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
32973672 |
caccatattccttgatt---------tcatcatcatcgatttgtt-tacataataaaatcaaaattaagcttaacaactaagtatccatcttcttctccc |
32973761 |
T |
 |
| Q |
201 |
gaatcagaaaaatggagttcccct |
224 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
32973762 |
gaatcagaaaaatggagttcccct |
32973785 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University