View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6377_high_1 (Length: 327)
Name: NF6377_high_1
Description: NF6377
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6377_high_1 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 289; Significance: 1e-162; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 289; E-Value: 1e-162
Query Start/End: Original strand, 17 - 320
Target Start/End: Original strand, 40624087 - 40624391
Alignment:
| Q |
17 |
aactttcaggtgcgttattttctttcagttatcactttttgcagttccaattttatgctcaaattttagaatgcaatttcgttgcatagtagctgcttga |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40624087 |
aactttcaggtgcgttattttctttcagttatcactttttgcagttccaattttatgctcaaattttagaatgcaatttcgttgcatagtagctgcttga |
40624186 |
T |
|
| Q |
117 |
aaaaatgccactaagagcttgtaggaagtgtgactttagcattctatagcagagttagtgacatggctcgttcacattaatctttcacacactaacattt |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
40624187 |
aaaaatgccactaagagcttgtaggaagtgtgactttagcattctatagcagagttagtgacatggctcgttcgcattaatctttcacacactaacattt |
40624286 |
T |
|
| Q |
217 |
gaaacactcatttgtgaccacttcattg-ccttttaaggttctctaatataactaaagttttacatattttgcttttcaaatatatcatctctatgacca |
315 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40624287 |
gaaacactcatttgtgaccacttcattgcccttttaaggttctctaatataactagagttttacatattttgcttttcaaatatatcatctctatgacca |
40624386 |
T |
|
| Q |
316 |
ttcat |
320 |
Q |
| |
|
||||| |
|
|
| T |
40624387 |
ttcat |
40624391 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University