View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6378_high_18 (Length: 283)
Name: NF6378_high_18
Description: NF6378
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6378_high_18 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 149; Significance: 9e-79; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 149; E-Value: 9e-79
Query Start/End: Original strand, 33 - 189
Target Start/End: Complemental strand, 34933196 - 34933040
Alignment:
| Q |
33 |
ggaaactaaagtaattaagagttggtgtgagcttaatctttttggtataccctttctctttaggccccagaagaggagaggtggtgtagtttgtagaata |
132 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34933196 |
ggaaactaaagtaattaagagttggtgtgagcttaatctttttggtataccctttctctttaggccccagaagaggagaggtggtgtagtttgtagaata |
34933097 |
T |
 |
| Q |
133 |
tgcatgtgctcccatatgaatcattgatttgtcttgtaaataattggatgaaagttc |
189 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
34933096 |
tgcatgtgttcccatatgaatcattgatttgtcttgtaaataatttgatgaaagttc |
34933040 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 72; E-Value: 8e-33
Query Start/End: Original strand, 192 - 267
Target Start/End: Complemental strand, 34933006 - 34932931
Alignment:
| Q |
192 |
tactatatgttattttataattggcatttgtcaaaaaagaatgttgtgttaaattattcagattaagggaataaat |
267 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34933006 |
tactgtatgttattttataattggcatttgtcaaaaaagaatgttgtgttaaattattcagattaagggaataaat |
34932931 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University