View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6378_high_19 (Length: 277)
Name: NF6378_high_19
Description: NF6378
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6378_high_19 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 120; Significance: 2e-61; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 143 - 266
Target Start/End: Complemental strand, 37221273 - 37221150
Alignment:
| Q |
143 |
cttttctatgataattttctgagcaaagagaattgttccatggagaaaacacaataacattgttcacaaagctttgtttgtgcaactggtgagttcacca |
242 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
37221273 |
cttttctatgataattttctgagcaaagagaattgttccatggagaaaacacaataacattgttcacaaagctttgtttttgcaactggtgagttcacca |
37221174 |
T |
|
| Q |
243 |
aaatctgtaatgcttggtttctgt |
266 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
37221173 |
aaatctgtaatgcttggtttctgt |
37221150 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 24 - 93
Target Start/End: Complemental strand, 37221389 - 37221320
Alignment:
| Q |
24 |
acccatctggaaaaaacttgaacacaaaacgaaacgacgtcgttttgtttgttactcttcaatgaaataa |
93 |
Q |
| |
|
|||||| || |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
37221389 |
acccatttgaaaaaaacttgaacacaaaacgaaacggcgtcgttttgtttgttactcttcaatgaaataa |
37221320 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 70; Significance: 1e-31; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 151 - 264
Target Start/End: Original strand, 37572190 - 37572303
Alignment:
| Q |
151 |
tgataattttctgagcaaagagaattgttccatggagaaaacacaataacattgttcacaaagctttgtttgtgcaactggtgagttcaccaaaatctgt |
250 |
Q |
| |
|
||||||||| | |||| ||||||||||||||||||||||||||| |||| | ||||||||||||||||||||||||| ||||||||||||| |||||| |
|
|
| T |
37572190 |
tgataatttcttcagcagagagaattgttccatggagaaaacacagtaacctcgttcacaaagctttgtttgtgcaaccggtgagttcaccagaatctgc |
37572289 |
T |
|
| Q |
251 |
aatgcttggtttct |
264 |
Q |
| |
|
|| ||||||||||| |
|
|
| T |
37572290 |
aaagcttggtttct |
37572303 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University