View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6378_high_25 (Length: 250)
Name: NF6378_high_25
Description: NF6378
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6378_high_25 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 181; Significance: 7e-98; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 181; E-Value: 7e-98
Query Start/End: Original strand, 44 - 236
Target Start/End: Original strand, 27154091 - 27154283
Alignment:
| Q |
44 |
gtattggtattttttgttgttctctaaagtttaggtcaggattatactagtatacgattaaattgattttttagattcttttttgatccacagttattat |
143 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||| |
|
|
| T |
27154091 |
gtattggtattttttgttgttctctaaagtttaggtcaggattatactagtatacgattaaattgagtttttagattcttttttgatccaaagttattat |
27154190 |
T |
|
| Q |
144 |
caatagaaatgatgagtttaaggaatgcaagattttgcttattctattgctttcctcacctaattacttcaattatagttacattttgttgtt |
236 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27154191 |
caatagaaatgatgaggttaaggaatgcaagattttgcttattctattgctttcctcacctaattacttcaattatagttacattttgttgtt |
27154283 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 39 - 222
Target Start/End: Original strand, 21435409 - 21435590
Alignment:
| Q |
39 |
acagtgtattggtattttttgttgttctctaaagtttaggtcaggattatactagtatacgattaaattgatt---ttttagattcttttttgatccaca |
135 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||| ||||||| ||||| |
|
|
| T |
21435409 |
acagtgtataggtattttttgttgttctctaaagtttagg-----attatactagtatacgattaaattgattactttttagattgttttttggtccact |
21435503 |
T |
|
| Q |
136 |
gttattatcaatagaaatgatgagtttaaggaatgcaagattttgcttattctattgctttcctcacctaattacttcaattatagt |
222 |
Q |
| |
|
||||||||| ||| | |||| |||||||| || || ||||||| || |||||||||| |||| ||| |||| ||||||||||||||| |
|
|
| T |
21435504 |
gttattatcgatacacatgaagagtttaatgagtgaaagatttggcgtattctattggtttcgtcaactaagtacttcaattatagt |
21435590 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University