View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6378_high_31 (Length: 239)
Name: NF6378_high_31
Description: NF6378
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6378_high_31 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 157; Significance: 1e-83; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 1 - 157
Target Start/End: Complemental strand, 54252646 - 54252490
Alignment:
| Q |
1 |
cacaagtacaagatggagatgtctttgcctgtggttgcaacagcttatgagatccaacaatgtttcatattttactgcagatttcttctatggcaaatgg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54252646 |
cacaagtacaagatggagatgtctttgcctgtggttgcaacagcttatgagatccaacaatgtttcatattttactgcagatttcttctatggcaaatgg |
54252547 |
T |
|
| Q |
101 |
gtcttcttagattcttcttatgtcaaagatggggtactcaactaccgaatgtgtact |
157 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54252546 |
gtcttcttagattcttcttatgtcaaagatggggtactcaactaccgaatgtgtact |
54252490 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 180 - 224
Target Start/End: Complemental strand, 54252467 - 54252423
Alignment:
| Q |
180 |
atgttgttgttttgctttttgattatcattatcatgttgttcttg |
224 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||| |||||| |
|
|
| T |
54252467 |
atgttgttgttttgctttttgattatcattatgatgttattcttg |
54252423 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University