View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6378_low_37 (Length: 210)
Name: NF6378_low_37
Description: NF6378
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6378_low_37 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 169; Significance: 8e-91; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 169; E-Value: 8e-91
Query Start/End: Original strand, 18 - 198
Target Start/End: Original strand, 14550905 - 14551085
Alignment:
| Q |
18 |
ctattaacctttagacaattggaggaaccataacactagtcgatttatagggtccctctttggaaaagaaacctatcttattctcttgatagtagagtat |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14550905 |
ctattaacctttagacaattggaggaaccataacacttgtcgatttagagggtccctctttggaaaagaaacctatcttattctcttgatagtagagtat |
14551004 |
T |
|
| Q |
118 |
agttttggttgggacatttgcttttgggaacaattttcgtactcatgctactactggcatgttacaaggtcttcatctcac |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
14551005 |
agttttggttgggacatttgcttttgggaacaattttcgtactcatgctactactggcatgttacaaggtcttcatttcac |
14551085 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University