View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6379_high_15 (Length: 369)
Name: NF6379_high_15
Description: NF6379
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6379_high_15 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 328; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 328; E-Value: 0
Query Start/End: Original strand, 2 - 353
Target Start/End: Complemental strand, 50633822 - 50633471
Alignment:
| Q |
2 |
ctcaaaagtaccaaggcgcatctatacaaacaagtcctatgtcacatgtagccacataacacactagagcactagtcatgctaaattagaggcattcata |
101 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||| |||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
50633822 |
ctcaaaagtcccaaggcgcatctatacaaacaagtcctatgtcacatgtagccaaataccacactagtgcactagtcatgctaaattagaggcattcata |
50633723 |
T |
 |
| Q |
102 |
aaagtaatacacggcatcaaacaaggcacaaaacaacatatcaataacttgctaaatttaatttagtgctaacgggataaagtcaaccaaccatatcaaa |
201 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50633722 |
aaagtaatacacagcatcaaacaaggcacaaaacaacatatcaataaattgctaaatttaatttagtgctaacgggataaagtcaaccaaccatatcaaa |
50633623 |
T |
 |
| Q |
202 |
ccaaatttactcaaaatcttctcagcatgaagagaacaacaaacacattgacacaagacaactggttcaattcagcaatctaaacagaaactacaccaaa |
301 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50633622 |
ccaaatttactcaaaatcttctcagcatgaagagaacaacaaacacattgacacaagacaactggttcaattcagcaatctaaacagaaactacaccaaa |
50633523 |
T |
 |
| Q |
302 |
atttctcattaaataatcagaaccagccccacaaaaagactagagttttatc |
353 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50633522 |
atttctcattaaataatcagaaccagccccacaaaaagactagagttttatc |
50633471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University