View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6379_high_24 (Length: 267)
Name: NF6379_high_24
Description: NF6379
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6379_high_24 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 145; Significance: 2e-76; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 19 - 254
Target Start/End: Original strand, 55990196 - 55990435
Alignment:
| Q |
19 |
gaccctgagatcgggttttaattattgagcgacttgccttcnnnnnnn-gcgacttggataaatacataatgaagggtgcttatgggttgctgctggtgt |
117 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
55990196 |
gaccctgagaccgggttttaattattgagcgacttgccttcttttttttgcgacttcgataaatacataatgaagggtgcttctgggttgctgctggtgt |
55990295 |
T |
|
| Q |
118 |
ctgttagagcttgctgaatgatttctaagtccttgttcacattcg---aacaaggatgcttcttgaaaacagaaaatgaacttttaacgaagnnnnnnnn |
214 |
Q |
| |
|
||||||||| ||||| |||||| |||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55990296 |
ctgttagagtttgcttaatgatctctaagtccttgttcacattcgaacaacaacgatgcttcttgaaaacagaaaatgaacttttaacgaagtttttttt |
55990395 |
T |
|
| Q |
215 |
agatcgattacaagtttaacggctctaaaatgtcatacct |
254 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55990396 |
agatcgattacaagtttaacggctctaaaatgtcatacct |
55990435 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 68; Significance: 2e-30; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 67 - 190
Target Start/End: Original strand, 3604862 - 3604985
Alignment:
| Q |
67 |
gcgacttggataaatacataatgaagggtgcttatgggttgctgctggtgtctgttagagcttgctgaatgatttctaagtccttgttcacattcgaaca |
166 |
Q |
| |
|
||||||| ||||||||| ||||||||||||||| || |||||||||||| |||| ||||||||| ||||||||||| ||||||||||| ||||||||||| |
|
|
| T |
3604862 |
gcgacttcgataaatacgtaatgaagggtgcttctgtgttgctgctggtatctgatagagcttgttgaatgatttcaaagtccttgttaacattcgaaca |
3604961 |
T |
|
| Q |
167 |
aggatgcttcttgaaaacagaaaa |
190 |
Q |
| |
|
||| ||| ||||||||| |||| |
|
|
| T |
3604962 |
tcgattcttattgaaaacataaaa |
3604985 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 107 - 184
Target Start/End: Original strand, 18460064 - 18460140
Alignment:
| Q |
107 |
gctgctggtgtctgttagagcttgctgaatgatttctaagtccttgttcacattcgaacaaggatgcttcttgaaaac |
184 |
Q |
| |
|
|||||||| || ||||| ||||||||||||||||||||||| |||||| || ||| |||| |||||||||| ||||| |
|
|
| T |
18460064 |
gctgctggagtttgttaaagcttgctgaatgatttctaagt-cttgttaactgtcggacaacgatgcttcttaaaaac |
18460140 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University