View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6379_high_26 (Length: 252)
Name: NF6379_high_26
Description: NF6379
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6379_high_26 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 15 - 252
Target Start/End: Original strand, 37860332 - 37860572
Alignment:
| Q |
15 |
atatatacaaacgtcaattgatatattttaaagttaattttaaatttt-attaattcaagtctacttatgataattttgttgctattt--gtatttctct |
111 |
Q |
| |
|
|||| |||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
37860332 |
atatgtacaaacgtcaatttatatattttaaagttaattttaaatttttattaattcaagtctacttatgataattttgttgctatttttgtatttctct |
37860431 |
T |
|
| Q |
112 |
cgtttacatttacatgacctaagagcatatccaatgtaggtacattagttgttctcttaaaaataaaattataaaatttagtannnnnnnaccattggag |
211 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
37860432 |
cgtttacatttacatgacccaagagcatatccaatgtaggtacattagttgttctcttaaaaataaaattataaaatttagtatttttttaccattggag |
37860531 |
T |
|
| Q |
212 |
tgtgttgatatggagtttgagattattttaaaataagttat |
252 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37860532 |
tgtgttgatatggagtttgagattattttaaaataagttat |
37860572 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University