View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6379_high_34 (Length: 230)
Name: NF6379_high_34
Description: NF6379
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6379_high_34 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 8 - 226
Target Start/End: Original strand, 28007874 - 28008088
Alignment:
| Q |
8 |
gacagcatggtgatattgttcaagatataaaatgtaacttacggtagctttatgtgattatgtcaatctcatcgtcaatctaaacatatactatttaatt |
107 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
28007874 |
gacagcatcgtgatattgttcaagatataaaatgtaacttacggtagctttatgtgattttgtcaatctcatcgtcaatctaaacatatactacttaatt |
28007973 |
T |
 |
| Q |
108 |
ggttgtaagtgaaaattcatattgcatttggaatgcgaacatatgcagactcccacacgtggaaaccaaatttctaatgtgaaaaataaaatcttttaag |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||| |||||||| || |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28007974 |
ggttgtaagtgaaaattcatattgcatttgtaatgcgaacat----agactcccgcaagtggaaaccaaatttctaatgtgaaaaataaaatcttttaag |
28008069 |
T |
 |
| Q |
208 |
tagaatgaagcaatagtat |
226 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
28008070 |
tagaatgaagcaatagtat |
28008088 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University