View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6379_high_35 (Length: 228)
Name: NF6379_high_35
Description: NF6379
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6379_high_35 |
 |  |
|
| [»] chr2 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 218; Significance: 1e-120; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 7 - 228
Target Start/End: Complemental strand, 37007429 - 37007208
Alignment:
| Q |
7 |
ctgttcaccacaagataacttgggccaaatggcccaacataaaagatggtcttcagggttgcttgatatcttccttagcaagcattgtccaatttttggt |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37007429 |
ctgttcaccacaagataacttgggccaaatggcccaacataaaagatggtctacagggttgcttgatatcttccttagcaagcattgtccaatttttggt |
37007330 |
T |
 |
| Q |
107 |
accctatttggtaagctacaatttagagagtgcttgtcatatatttggatcactaattgggcattaagatctatccctgaaatatgttatgctcttctac |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37007329 |
accctatttggtaagctacaatttagagagtgcttgtcatatatttggatcactaattgggcattaagatctatccctgaaatatgttatgctcttctac |
37007230 |
T |
 |
| Q |
207 |
ctgcctattgcatcattaccaa |
228 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
37007229 |
ctgcctattgcatcattaccaa |
37007208 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 163 - 219
Target Start/End: Complemental strand, 37024124 - 37024068
Alignment:
| Q |
163 |
ttgggcattaagatctatccctgaaatatgttatgctcttctacctgcctattgcat |
219 |
Q |
| |
|
||||||||||||||| |||||||||| ||||||||| |||||||||||||||||| |
|
|
| T |
37024124 |
ttgggcattaagatcggtccctgaaatctgttatgctgctctacctgcctattgcat |
37024068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University