View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6379_high_37 (Length: 210)
Name: NF6379_high_37
Description: NF6379
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6379_high_37 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 1 - 190
Target Start/End: Complemental strand, 42057272 - 42057082
Alignment:
| Q |
1 |
acctaatctagggatattatatatcccattacatcataccgaaatttaagagttaatgaagaataagagagattgagtccaaaagcatgaaccgtgttga |
100 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||| |||||| |
|
|
| T |
42057272 |
acctaatctagggataatatatatcccattacatcataccgaaatttaagagttaatgaagcaaaagagagattgagtccaaaagcatgaaccatgttga |
42057173 |
T |
 |
| Q |
101 |
tatatataa-ttcgcatttgacttttatttttggtggactaattcccttgtgtgtttgggagtggttatttagtttagagaaattatattt |
190 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||| || |||||||||||| |||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
42057172 |
tatatataatttcgcatttgacttttatttttggtagattaattcccttgtatgtttgggagtggtcatttagtttagaaaaattatattt |
42057082 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University