View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6379_high_39 (Length: 204)
Name: NF6379_high_39
Description: NF6379
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6379_high_39 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 1 - 186
Target Start/End: Original strand, 3111802 - 3111987
Alignment:
| Q |
1 |
agccaaaatcaccacttggaaattcagaagttctcgatattataagtcgctgcaactcaaccggtggtccatctggaagattttgggtactagatcctgt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3111802 |
agccaaaatcaccacttggaaattcagaagttctcgatattataagtcgctgcaactcaaccggtggtccatctggaagattttgggtactagatcctgt |
3111901 |
T |
 |
| Q |
101 |
tgatggcacactcgggtttgttcgtggcgatcaatatgctgtagctctagcgctcgtagaggatggagaagtagtgcttggtgttc |
186 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3111902 |
tgatggcacactcgggtttgttcgtggcgatcaatatgctgtagctctagcgctcgtagaggatggagaagtagtgcttggtgttc |
3111987 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 48; Significance: 1e-18; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 3 - 186
Target Start/End: Complemental strand, 35894221 - 35894038
Alignment:
| Q |
3 |
ccaaaatcaccacttggaaattcagaagttctcgatattataagtcgctgcaactcaaccggtggtccatctggaagattttgggtactagatcctgttg |
102 |
Q |
| |
|
||||||||| | ||||||| |||||| ||||| || || || |||| |||||||||| || |||| || ||||||||||||| |||| |||| ||| |
|
|
| T |
35894221 |
ccaaaatcagctcttggaacttcagaggttcttgaaatcattagtcactgcaactcagttgggggtcattcgggaagattttgggcactaagtcctcttg |
35894122 |
T |
 |
| Q |
103 |
atggcacactcgggtttgttcgtggcgatcaatatgctgtagctctagcgctcgtagaggatggagaagtagtgcttggtgttc |
186 |
Q |
| |
|
|||| | | | || ||||| ||| |||||||||||||||||| || | |||||||||||||||||||| ||| ||||||||| |
|
|
| T |
35894121 |
atggtaaattgggatttgtaaatggtgatcaatatgctgtagctttatcactcgtagaggatggagaagtggtggttggtgttc |
35894038 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University