View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6379_low_27 (Length: 252)

Name: NF6379_low_27
Description: NF6379
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6379_low_27
NF6379_low_27
[»] chr1 (2 HSPs)
chr1 (15-126)||(50634322-50634433)
chr1 (191-252)||(50634241-50634302)


Alignment Details
Target: chr1 (Bit Score: 104; Significance: 6e-52; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 104; E-Value: 6e-52
Query Start/End: Original strand, 15 - 126
Target Start/End: Complemental strand, 50634433 - 50634322
Alignment:
15 cacagacctcatacaaactactcaagaccttcaccactaatctaatccttgtggcttttctttaacttgttctttttagtactgttatgagttataacat 114  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||     
50634433 cacagacctcatacaaactactcaagaccttcaccactaatctaatccttgtggcttttctttagcttgttctttttagtactgttatgagttataacac 50634334  T
115 gacagtaatact 126  Q
    ||||||||||||    
50634333 gacagtaatact 50634322  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 191 - 252
Target Start/End: Complemental strand, 50634302 - 50634241
Alignment:
191 gatgctttatgcagcagctataacatgcaactggattagttttgattccgagcatccaagtc 252  Q
    |||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||    
50634302 gatgctttatgcagcagctataacatgcaactagattagttttgattccgagtatccaagtc 50634241  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University