View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6379_low_27 (Length: 252)
Name: NF6379_low_27
Description: NF6379
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6379_low_27 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 104; Significance: 6e-52; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 104; E-Value: 6e-52
Query Start/End: Original strand, 15 - 126
Target Start/End: Complemental strand, 50634433 - 50634322
Alignment:
| Q |
15 |
cacagacctcatacaaactactcaagaccttcaccactaatctaatccttgtggcttttctttaacttgttctttttagtactgttatgagttataacat |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
50634433 |
cacagacctcatacaaactactcaagaccttcaccactaatctaatccttgtggcttttctttagcttgttctttttagtactgttatgagttataacac |
50634334 |
T |
 |
| Q |
115 |
gacagtaatact |
126 |
Q |
| |
|
|||||||||||| |
|
|
| T |
50634333 |
gacagtaatact |
50634322 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 191 - 252
Target Start/End: Complemental strand, 50634302 - 50634241
Alignment:
| Q |
191 |
gatgctttatgcagcagctataacatgcaactggattagttttgattccgagcatccaagtc |
252 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||| |
|
|
| T |
50634302 |
gatgctttatgcagcagctataacatgcaactagattagttttgattccgagtatccaagtc |
50634241 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University