View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6379_low_31 (Length: 243)
Name: NF6379_low_31
Description: NF6379
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6379_low_31 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 138; Significance: 3e-72; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 1 - 226
Target Start/End: Original strand, 37860679 - 37860902
Alignment:
| Q |
1 |
cttaactttatcaccatttgagtaaaatgtagtttgatcccttgaaaattgcttaaata---ctagatagcaatttgagttgaacccccnnnnnnnnnnn |
97 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||| | |
|
|
| T |
37860679 |
cttaactttatcaccatttgagtaaaatgtagtttgatcccttgaaaattgcttaaataatactaaatagcaatttgagttgaacccacaaaaaaaaaaa |
37860778 |
T |
 |
| Q |
98 |
nnnnntaatcatccattgaagttaccatttgatcggagatgctctaaatatgcttccatcactttttgttgtttaaaaacatttgcacttgaaacaatct |
197 |
Q |
| |
|
|||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37860779 |
t----taatcatccattgaagttaccatt-gattggagatgctctaaatatgcttccatcactttttgttgtttaaaaacatttgcacttgaaacaatct |
37860873 |
T |
 |
| Q |
198 |
aacaatcgacacggtttaccctccatgtt |
226 |
Q |
| |
|
||||||||||| ||||||||||||||||| |
|
|
| T |
37860874 |
aacaatcgacatggtttaccctccatgtt |
37860902 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University