View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6379_low_32 (Length: 238)
Name: NF6379_low_32
Description: NF6379
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6379_low_32 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 104; Significance: 6e-52; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 104; E-Value: 6e-52
Query Start/End: Original strand, 80 - 222
Target Start/End: Original strand, 28632090 - 28632229
Alignment:
| Q |
80 |
tcataacttgaatattcaactcgtttagatatatgtatttttagtaagaaaaagacaaatccaccccacgtaaaaaacaaaataattagtctttcaattt |
179 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||| |||||||||||||||||||| |||| |
|
|
| T |
28632090 |
tcataacttgaatattcaactcgtttagatatatgtatttttagtaagaaaaggacaag--caccccacgtaaagaacaaaataattagtctttccattt |
28632187 |
T |
 |
| Q |
180 |
acatgcatatataatccacaactacaaaaattgatgatataat |
222 |
Q |
| |
|
||||||||||||||||||||||||| |||||| |||||||||| |
|
|
| T |
28632188 |
acatgcatatataatccacaactac-aaaattaatgatataat |
28632229 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 1 - 92
Target Start/End: Original strand, 28631975 - 28632067
Alignment:
| Q |
1 |
tagttcctttaattatgtttacggtctttaaacaaggccgaattctaattcataacttttgtg-ttacggaaattttaattcataacttgaat |
92 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||| |
|
|
| T |
28631975 |
tagttcctttaattatgtttacggtctttaaacaaggccgaattctaattcataacttttctgtttacggaaattttaattcataacttgaat |
28632067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University