View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6379_low_34 (Length: 238)
Name: NF6379_low_34
Description: NF6379
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6379_low_34 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 75; Significance: 1e-34; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 9 - 83
Target Start/End: Complemental strand, 38498617 - 38498543
Alignment:
| Q |
9 |
acatcatcacttccaaaggtccctactccaataagaactccggtgttgatgcacgcgatctcaagtaatcacctg |
83 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38498617 |
acatcatcacttccaaaggtccctactccaataagaactccggtgttgatgcacgcgatctcaagtaatcacctg |
38498543 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 167 - 238
Target Start/End: Complemental strand, 38498459 - 38498388
Alignment:
| Q |
167 |
ccggtgtgtgtttgattctacagtgagaaaaattgatttggaattatatgattttgtaaacttgattctggc |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38498459 |
ccggtgtgtgtttgattctacagtgagaaaaattgatttggaattatatgattttgtaaacttgattctggc |
38498388 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University