View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6379_low_40 (Length: 212)
Name: NF6379_low_40
Description: NF6379
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6379_low_40 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 122; Significance: 9e-63; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 122; E-Value: 9e-63
Query Start/End: Original strand, 20 - 169
Target Start/End: Complemental strand, 31416310 - 31416161
Alignment:
| Q |
20 |
ctgcgtgagtcatggaggaatccttatagttctatgagtgggttgttgaaccttttgtttatcttttaagatacctctttgtacggttacctagnnnnnn |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
31416310 |
ctgcgtgagtcatggaggaatccttatagttctatgagtgggttgttgaaccttttgtttatcttttaagatagctctttgtacggttacctagtttttt |
31416211 |
T |
|
| Q |
120 |
nncagcgctgttatacacaccgaataattagccaatcatgtgaattcttg |
169 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31416210 |
ttcagcgctgttatacacaccgaataattagccaatcatgtgaattcttg |
31416161 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University