View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6379_low_42 (Length: 205)
Name: NF6379_low_42
Description: NF6379
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6379_low_42 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 173; Significance: 3e-93; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 173; E-Value: 3e-93
Query Start/End: Original strand, 13 - 189
Target Start/End: Original strand, 42969028 - 42969204
Alignment:
| Q |
13 |
atcacatatattggacttaccaatggtaatcccatctgggtctaactttggtcatccgattttcaccatatggataatctgtttcagctcttcttgcatt |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42969028 |
atcacatatattggacttaccaatggtaatcccatctgggtctaactttggtcatccgattttcaccatatggataatctgtttcagctcttcttgcatt |
42969127 |
T |
 |
| Q |
113 |
tctgaaagcacaacatccaattgaataaatccctatgagcaaaataagcattgtgacagttagaactgatagcttat |
189 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42969128 |
tctaaaagcacaacatccaattgaataaatccctatgagcaaaataagcattgtgacagttagaactgatagcttat |
42969204 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 78; Significance: 2e-36; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 27 - 148
Target Start/End: Original strand, 10678203 - 10678324
Alignment:
| Q |
27 |
acttaccaatggtaatcccatctgggtctaactttggtcatccgattttcaccatatggataatctgtttcagctcttcttgcatttctgaaagcacaac |
126 |
Q |
| |
|
|||||||||| |||||||||||| ||||||||||| |||| ||||||||||||| ||||||||| ||||||| |||||||||||||||||||||||||| |
|
|
| T |
10678203 |
acttaccaatagtaatcccatctaggtctaactttcctcatacgattttcaccatgtggataatcagtttcagatcttcttgcatttctgaaagcacaac |
10678302 |
T |
 |
| Q |
127 |
atccaattgaataaatccctat |
148 |
Q |
| |
|
||||||| ||||| || ||||| |
|
|
| T |
10678303 |
atccaatagaatatattcctat |
10678324 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University