View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6380_high_7 (Length: 207)
Name: NF6380_high_7
Description: NF6380
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6380_high_7 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 68; Significance: 1e-30; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 68; E-Value: 1e-30
Query Start/End: Original strand, 24 - 91
Target Start/End: Complemental strand, 11401897 - 11401830
Alignment:
| Q |
24 |
tcaataactgaaatctaatttcgaaccgaacgatgttgtagttgttcatcataactctcttagaatat |
91 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11401897 |
tcaataactgaaatctaatttcgaaccgaacgatgttgtagttgttcatcataactctcttagaatat |
11401830 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 54; E-Value: 3e-22
Query Start/End: Original strand, 133 - 190
Target Start/End: Complemental strand, 11401828 - 11401771
Alignment:
| Q |
133 |
ctcttgttattcaacaaactttgatttactttacaacggactacaagacaccctttat |
190 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11401828 |
ctcttgttattcaacacactttgatttactttacaacggactacaagacaccctttat |
11401771 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University