View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6380_low_12 (Length: 207)

Name: NF6380_low_12
Description: NF6380
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6380_low_12
NF6380_low_12
[»] chr8 (2 HSPs)
chr8 (24-91)||(11401830-11401897)
chr8 (133-190)||(11401771-11401828)


Alignment Details
Target: chr8 (Bit Score: 68; Significance: 1e-30; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 68; E-Value: 1e-30
Query Start/End: Original strand, 24 - 91
Target Start/End: Complemental strand, 11401897 - 11401830
Alignment:
24 tcaataactgaaatctaatttcgaaccgaacgatgttgtagttgttcatcataactctcttagaatat 91  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
11401897 tcaataactgaaatctaatttcgaaccgaacgatgttgtagttgttcatcataactctcttagaatat 11401830  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 54; E-Value: 3e-22
Query Start/End: Original strand, 133 - 190
Target Start/End: Complemental strand, 11401828 - 11401771
Alignment:
133 ctcttgttattcaacaaactttgatttactttacaacggactacaagacaccctttat 190  Q
    |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||    
11401828 ctcttgttattcaacacactttgatttactttacaacggactacaagacaccctttat 11401771  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University