View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6380_low_14 (Length: 202)
Name: NF6380_low_14
Description: NF6380
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6380_low_14 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 133; Significance: 2e-69; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 133; E-Value: 2e-69
Query Start/End: Original strand, 1 - 157
Target Start/End: Original strand, 18210224 - 18210380
Alignment:
| Q |
1 |
tcatcaaccaaagttcagtaatggagcatatatcaaatttttctattgatcaaaattagatattggatcactactactgaagagacattaaacaactatg |
100 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18210224 |
tcatcaaccaaagttcagtaatggagcgtatatcaaatttttctattgataaaaattagatattggatcactactactgaagagacattaaacaactatg |
18210323 |
T |
 |
| Q |
101 |
acaaaaacacactgcagcaactctgcaatgttattcccatagtaaaatttcaagaca |
157 |
Q |
| |
|
||||||||||||||||| ||||| ||||||||||||||| |||||||||||||||| |
|
|
| T |
18210324 |
acaaaaacacactgcagtaactccacaatgttattcccattgtaaaatttcaagaca |
18210380 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University