View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6382_high_15 (Length: 237)

Name: NF6382_high_15
Description: NF6382
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6382_high_15
NF6382_high_15
[»] chr2 (1 HSPs)
chr2 (1-222)||(2923694-2923915)
[»] chr4 (2 HSPs)
chr4 (42-222)||(36127139-36127319)
chr4 (40-125)||(16009871-16009956)


Alignment Details
Target: chr2 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 2923915 - 2923694
Alignment:
1 atagtttgtctcatttgatgtgtccttttgctcttttcgtataggtttgataaaaggataacagcttttgccgaagacaagtttcaaagagatgggattg 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2923915 atagtttgtctcatttgatgtgtccttttgctcttttcgtataggtttgataaaaggataacagcttttgccgaagacaagtttcaaagagatgggattg 2923816  T
101 atgtgaaaacaggatccatggttgtgaaggtagatgggaaagaaatttccactaaagagctgaaaaatggaggaaagattactacaattccatatggaat 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2923815 atgtgaaaacaggatccatggttgtgaaggtagatgggaaagaaatttccactaaagagctgaaaaatggaggaaagattactacaattccatatggaat 2923716  T
201 ggctgtctggtcaactggtatt 222  Q
    ||||||||||||||||||||||    
2923715 ggctgtctggtcaactggtatt 2923694  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 93; Significance: 2e-45; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 42 - 222
Target Start/End: Original strand, 36127139 - 36127319
Alignment:
42 taggtttgataaaaggataacagcttttgccgaagacaagtttcaaagagatgggattgatgtgaaaacaggatccatggttgtgaaggtagatgggaaa 141  Q
    ||||||||| ||||| |||||| | ||||| |||||||||||  |||||||||| |||||||||||||||||||||||||||   ||||||  ||  | |    
36127139 taggtttgacaaaagaataacaacctttgctgaagacaagttcaaaagagatggtattgatgtgaaaacaggatccatggttacaaaggtatctgacaga 36127238  T
142 gaaatttccactaaagagctgaaaaatggaggaaagattactacaattccatatggaatggctgtctggtcaactggtatt 222  Q
    |||||| ||||||||||  |||||||||||||| | |||||||| ||||||||||||||||||||||||||||||||||||    
36127239 gaaattaccactaaagaaatgaaaaatggaggagaaattactactattccatatggaatggctgtctggtcaactggtatt 36127319  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 40 - 125
Target Start/End: Complemental strand, 16009956 - 16009871
Alignment:
40 tataggtttgataaaaggataacagcttttgccgaagacaagtttcaaagagatgggattgatgtgaaaacaggatccatggttgt 125  Q
    ||||||||||| || || |||||||  ||||| ||||| |||||  |||||||||| ||||||||||||   ||||| ||||||||    
16009956 tataggtttgacaagagaataacagaatttgctgaagaaaagttcaaaagagatggaattgatgtgaaattgggatcaatggttgt 16009871  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University