View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6382_low_20 (Length: 210)
Name: NF6382_low_20
Description: NF6382
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6382_low_20 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 171; Significance: 5e-92; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 171; E-Value: 5e-92
Query Start/End: Original strand, 7 - 210
Target Start/End: Complemental strand, 27633162 - 27632960
Alignment:
| Q |
7 |
gaactatcttcgaccaaatctcaaacatggcccttttaatgttgaagaggagagacttattgttcagcttcagcagcaatggggtaacaagtgagtttct |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27633162 |
gaactatcttcgaccaaatctcaaacatggcccttttaatgttgaagaggagagacttattgttcagcttcagcagcaatggggtaacaagtgagtttct |
27633063 |
T |
|
| Q |
107 |
tcccctgcttgtagtaactagtaaccataaaatgtctaagcctatgaagttgnnnnnnnntataatatagtatatagttaaatttaattagtatgcattg |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
27633062 |
tcccctgcttgtagtaactagtaaccataaaatgtctaagcctatgaagttg-aaaaatatataatatagtatatagttgaatttaattagtatgcattg |
27632964 |
T |
|
| Q |
207 |
tcaa |
210 |
Q |
| |
|
|||| |
|
|
| T |
27632963 |
tcaa |
27632960 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University