View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6382_low_5 (Length: 347)
Name: NF6382_low_5
Description: NF6382
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6382_low_5 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 255; Significance: 1e-142; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 255; E-Value: 1e-142
Query Start/End: Original strand, 1 - 337
Target Start/End: Complemental strand, 50954245 - 50953906
Alignment:
| Q |
1 |
ctgaatgccttccctgggtgtggtttatatttccagcaaaactgaagtttgttttaatgtttgatgtcggtgttgtgtgtaaattagattattcactcga |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
50954245 |
ctgaatgccttccctgggtgtggtttatatttccagcaaaactgaagtttgttttaatgtttgctgtcggtgttgtgtgtaaattagattattcactcga |
50954146 |
T |
 |
| Q |
101 |
aagatcagggttttaaatgtttgttcaaaggagcaggtattgttannnnnnnnnnnn-----ggggggagtatggattggttggttgcaaatctcattga |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||| ||||||||| |
|
|
| T |
50954145 |
aagatcagggttttaaatgtttgttcaaaggagcaggtattgtttatttttatttttttggggggggtagtatggattggttggttgcaattctcattga |
50954046 |
T |
 |
| Q |
196 |
tatgtatatttatttatttattcaattggggaaaagagaagggtactgtgtaccatgtatttcagctttgagagctgaggcatcatgtcacgaactaaag |
295 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
50954045 |
tatgtatatttatttatttattcaattggg--aaagagaagggtactgtgtaccatgtatttcagctttgagagctgaggcatcatgtcacgagctaaag |
50953948 |
T |
 |
| Q |
296 |
tgtattgtataacaatttttctgatgagttaaaggttctgtg |
337 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50953947 |
tgtattgtataacaatttttctgatgagttaaaggttctgtg |
50953906 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University