View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6382_low_8 (Length: 290)
Name: NF6382_low_8
Description: NF6382
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6382_low_8 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 21 - 288
Target Start/End: Original strand, 3182682 - 3182949
Alignment:
| Q |
21 |
agcttggggttattttcataaattctctcaaagtcaaacacgtaaatattttatgtcatatgataagctcaaacgaattgtaaataaataaactcttcca |
120 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||| |||||||||||||||||||| | |
|
|
| T |
3182682 |
agcttggggttatcttcataaattctctcaaagtcaaacacttaaatattttatgtcatatgataagctcgaacgaactgtaaataaataaactcttcaa |
3182781 |
T |
 |
| Q |
121 |
aacacacagaaagtcacaacacgactaccgtgatttgataaataataattaccaattacgaattcaagcaatagaaaaacattgacaaagctactaatcg |
220 |
Q |
| |
|
|||||||||||| ||| ||||| |||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3182782 |
aacacacagaaattcataacacaactatcgtgatttgatgaataataattaccaattacgaattcaagcaatagaaaaacattgacaaagctactaatcg |
3182881 |
T |
 |
| Q |
221 |
gtgagaaaggtggaagagaacaattaccctgcagctgagctgagcagaaatgaagcacaaacgcacca |
288 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3182882 |
gtgagaaaggtggaagagaacaattaccctgcagctgagctgagcagaaatgaagcacaaacgcacca |
3182949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University