View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6383_low_14 (Length: 238)
Name: NF6383_low_14
Description: NF6383
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6383_low_14 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 44204992 - 44205213
Alignment:
| Q |
1 |
ctttccaccaggaatagggagaatatctttgaaagcaagtgaagtgattgagttcaagtgtttaatgagctccatccaccaaagtatgaattgttcagga |
100 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
44204992 |
ctttccactaggaatagggagaatatctttgaaagcaagtgaagtgattgagttcaagtgtttaatgagctcca----ccaaagtatgaattgttcagga |
44205087 |
T |
|
| Q |
101 |
caactgagttcgattttttggtgaaacaatttcttgatcacctcacaaccaagagaataccttcgcaa---ttttacttcattcttaaactagcaggagc |
197 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||| || ||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
44205088 |
caactgagttcaattttttggtgaaacaatttcttgatcacctcacagccgagagaataccttcgcaatttttttacttcattcttaaactagcaggagc |
44205187 |
T |
|
| Q |
198 |
aacattttgatttttgtctgctagat |
223 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
44205188 |
aacattttgatttttgtctgctagat |
44205213 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University