View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6383_low_15 (Length: 213)

Name: NF6383_low_15
Description: NF6383
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6383_low_15
NF6383_low_15
[»] chr8 (1 HSPs)
chr8 (12-194)||(13216360-13216539)


Alignment Details
Target: chr8 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 12 - 194
Target Start/End: Complemental strand, 13216539 - 13216360
Alignment:
12 attatactaccaaccgaccattaaaaaagagataaagtgtttaatttttcagtataataaaatatgagagtatgatcaatttgtacaatttagttgacaa 111  Q
    |||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||   ||||||||||||||||||||||||||||||||||||||||    
13216539 attatattaccaaccgaccattaaaaaagagataaagtgtgtaatttttcagtataa---aatatgagagtatgatcaatttgtacaatttagttgacaa 13216443  T
112 acaccatagattttgcaaactttttagtttcgctcttgggagtagtttcttagtattattaattttgactcaagtttcttaat 194  Q
    ||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
13216442 acaccatagattttgtaaactttttaatttcgctcttgggagtagtttcttagtattattaattttgactcaagtttcttaat 13216360  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University