View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6383_low_15 (Length: 213)
Name: NF6383_low_15
Description: NF6383
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6383_low_15 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 12 - 194
Target Start/End: Complemental strand, 13216539 - 13216360
Alignment:
| Q |
12 |
attatactaccaaccgaccattaaaaaagagataaagtgtttaatttttcagtataataaaatatgagagtatgatcaatttgtacaatttagttgacaa |
111 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13216539 |
attatattaccaaccgaccattaaaaaagagataaagtgtgtaatttttcagtataa---aatatgagagtatgatcaatttgtacaatttagttgacaa |
13216443 |
T |
 |
| Q |
112 |
acaccatagattttgcaaactttttagtttcgctcttgggagtagtttcttagtattattaattttgactcaagtttcttaat |
194 |
Q |
| |
|
||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13216442 |
acaccatagattttgtaaactttttaatttcgctcttgggagtagtttcttagtattattaattttgactcaagtttcttaat |
13216360 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University