View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6384_low_10 (Length: 228)
Name: NF6384_low_10
Description: NF6384
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6384_low_10 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 5 - 219
Target Start/End: Complemental strand, 38851247 - 38851031
Alignment:
| Q |
5 |
catacattcatatcaaagttgtcataataaactctcatttttgcaaacctgtaaatac--tctccaaattgtaaagtataatttaaaatgattcttttac |
102 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||| ||||| |||||| |
|
|
| T |
38851247 |
catacattcatatcaaagttgtcataataaactctcatttttgcaaagctgtaaatacattctccaaattgtaaagtataatttaaagtgatttttttac |
38851148 |
T |
 |
| Q |
103 |
tatgttttgtttttagactatgaggtgacacgttaaattgacgtgtgaaattgcccgttaattccacatcattgtcaactttatatgaactaattgaatg |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38851147 |
tatgttttgtttttagactatgaggtgacatgttaaattgacgtgtgaaattgcccgttaattccacatcattgtcaactttatatgaactaattgaatg |
38851048 |
T |
 |
| Q |
203 |
tgttacttttatgacat |
219 |
Q |
| |
|
|||||| |||||||||| |
|
|
| T |
38851047 |
tgttacctttatgacat |
38851031 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University