View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6384_low_9 (Length: 239)
Name: NF6384_low_9
Description: NF6384
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6384_low_9 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 134; Significance: 7e-70; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 134; E-Value: 7e-70
Query Start/End: Original strand, 55 - 222
Target Start/End: Original strand, 6210047 - 6210213
Alignment:
| Q |
55 |
ggaggcctttccaaaacagaagcaacaaactcttgttattctctctaagttttctgaagtattttaatatcagaaaaaacagagcaaagaaacagatgaa |
154 |
Q |
| |
|
|||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6210047 |
ggagtcctttccaaaacagaagctacaaactcttgttattctctctaagttttctgaagtattttaatatcagaaaaaacagagcaaagaaacagatgaa |
6210146 |
T |
|
| Q |
155 |
gtattaaggctctctagtcaacgcatcaatagannnnnnnagtttaaaggaagtgggcagccgtgaac |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
6210147 |
gtattaaggctctctagtcaacgcatcaataga-ttttttagtttaaaggaagtgggcagccgtgaac |
6210213 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University