View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6386_high_13 (Length: 246)

Name: NF6386_high_13
Description: NF6386
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6386_high_13
NF6386_high_13
[»] chr4 (1 HSPs)
chr4 (16-229)||(2861403-2861616)


Alignment Details
Target: chr4 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 16 - 229
Target Start/End: Complemental strand, 2861616 - 2861403
Alignment:
16 tgaacaccgcgaacaaccggaagaggaaggtaacgataaagaaatgacattaaaccggttgtaccgagcacgagaaggacagcagctacacataaaccag 115  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2861616 tgaacaccgcgaacaaccggaagaggaaggtaacgataaagaaatgacattaaaccggttgtaccgagcacgagaaggacagcagctacacataaaccag 2861517  T
116 ctgcagatatttgaggaatggtgagaggtggtgattctgagatggcaactgctgcaatggatttcataggctggactggcataggcagaccgaagaagag 215  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2861516 ctgcagatatttgaggaatggtgagaggtggtgattctgagatggcaactgctgcaatggatttcataggctggactggcataggcagaccgaagaagag 2861417  T
216 gccggtggtgatgt 229  Q
    ||||||||||||||    
2861416 gccggtggtgatgt 2861403  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University