View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6386_high_9 (Length: 309)
Name: NF6386_high_9
Description: NF6386
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6386_high_9 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 102; Significance: 1e-50; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 102; E-Value: 1e-50
Query Start/End: Original strand, 20 - 150
Target Start/End: Original strand, 47291259 - 47291391
Alignment:
| Q |
20 |
acgcaaactttaaaaatgaatttacattata--atacaatgctcagctctagtgaacgagatatgttaccaaaggacctacaatcctaatccatttaaga |
117 |
Q |
| |
|
||||||||||| ||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
47291259 |
acgcaaactttgaaaatgaatttacattatataatacaatgttcagctctagtgaacgagatatgttaccaaaggacctacaatcctaatcaatttaaga |
47291358 |
T |
 |
| Q |
118 |
ttgtaaggttctcggatgtactagatgcaccgt |
150 |
Q |
| |
|
||||||| ||||||||||||| ||||||||||| |
|
|
| T |
47291359 |
ttgtaagattctcggatgtaccagatgcaccgt |
47291391 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 189 - 302
Target Start/End: Original strand, 47291395 - 47291511
Alignment:
| Q |
189 |
gatcatcagtgtcactgttaataannnnnnngaaccttatgacat--ttaatatattgttcatgtattcattc-nnnnnnnnnngtcaaatagtctaata |
285 |
Q |
| |
|
||||||||||||| ||||||||| |||||||||||||| |||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
47291395 |
gatcatcagtgtcgttgttaataatttttttgaaccttatgacatatttaatatattgttcatgtattcattctttctttttttgtcaaatagtctaata |
47291494 |
T |
 |
| Q |
286 |
gttaaatattcatctct |
302 |
Q |
| |
|
|||| |||||||||||| |
|
|
| T |
47291495 |
gttagatattcatctct |
47291511 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 270 - 302
Target Start/End: Complemental strand, 2042957 - 2042925
Alignment:
| Q |
270 |
gtcaaatagtctaatagttaaatattcatctct |
302 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| |
|
|
| T |
2042957 |
gtcaaatagtctaatagttaaaaattcatctct |
2042925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University