View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6386_low_16 (Length: 245)
Name: NF6386_low_16
Description: NF6386
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6386_low_16 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 139; Significance: 7e-73; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 139; E-Value: 7e-73
Query Start/End: Original strand, 57 - 228
Target Start/End: Original strand, 31185913 - 31186083
Alignment:
| Q |
57 |
gtgatatttactttgtcagcctcgtactattttggaaaataaactgcaaagtcnnnnnnnactgcttcaaccagaatttgttttcattttcacttaaata |
156 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
31185913 |
gtgatatttactttgtcagcctcgtactattttggaaaataaactgcaaagtctttttttactgcttcaaccagaatttgttt-cattttcacttaaata |
31186011 |
T |
|
| Q |
157 |
ctaaaaagtgacgaaatttgcatataaaattggatgatgaatgatgttcacctaaaatagaatacgataaat |
228 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31186012 |
ctaaaaagtgacgaaatttgcatataaaattggacgatgaatgatgttcacctaaaatagaatacgataaat |
31186083 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University