View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6387_low_4 (Length: 205)
Name: NF6387_low_4
Description: NF6387
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6387_low_4 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 179; Significance: 8e-97; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 179; E-Value: 8e-97
Query Start/End: Original strand, 2 - 192
Target Start/End: Complemental strand, 3846984 - 3846794
Alignment:
| Q |
2 |
aatttttgtgttatgaatgtgttaggatttatcttatgaattttttatgaatttatgcgttagaaattggttaggttgttgttgaattttgagagagaat |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3846984 |
aatttttgtgttatgaatgtgttaggatttatcttatgaattttttatgaatttatgcgttagaaattggttaggttgttgttgaattttgagagagaat |
3846885 |
T |
|
| Q |
102 |
tgagctgaattcgaagatggatgcttcatatttactggccatgcagcactaacactttagattgaatgcatgtccggtatgtgatatgcct |
192 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
3846884 |
tgagctgaattcgaagatggatacttcatatttactggccatgcagcactgacaatttagattgaatgcatgtccggtatgtgatatgcct |
3846794 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 155 - 189
Target Start/End: Complemental strand, 3846748 - 3846714
Alignment:
| Q |
155 |
actttagattgaatgcatgtccggtatgtgatatg |
189 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
3846748 |
actttagattgaatgcatgtccggtatgtgatatg |
3846714 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University