View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6389_high_7 (Length: 319)
Name: NF6389_high_7
Description: NF6389
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6389_high_7 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 174; Significance: 1e-93; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 88 - 303
Target Start/End: Original strand, 8446873 - 8447089
Alignment:
| Q |
88 |
ccaaatgccagcaacataagagttagaaatttgcatctctccctct--caaacatctggtgaaaaatttgcaacgacccacattttgcaatacatatcaa |
185 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8446873 |
ccaaatgccaacaacataagagttagaaatttgcatctctccctctctcaaacatctggtgaaaaatttgcaacgacccacattttgcaatacatatcaa |
8446972 |
T |
 |
| Q |
186 |
ccaaacaagttttgaccaaaacattataagcagatttgtagtcacacnnnnnnnaaacataagcgtgaatggaccttattcttccctttcatatcttaaa |
285 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
8446973 |
ccaaacaagttttgaccaaaacattataagcagatttgtagtcacactttttttaaacataagcgtgaatggaccttattcttccctttcatatc-taaa |
8447071 |
T |
 |
| Q |
286 |
gtaagagtaacaattata |
303 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
8447072 |
gtaagagtaacaattata |
8447089 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 12 - 47
Target Start/End: Original strand, 8446838 - 8446873
Alignment:
| Q |
12 |
atgaacagattacagattggttgtcgttcgctgttc |
47 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
8446838 |
atgaacagattacagattggttgtcgttcgctgttc |
8446873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 32; Significance: 0.000000007; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 150 - 209
Target Start/End: Original strand, 19452129 - 19452187
Alignment:
| Q |
150 |
aatttgcaacgacccacattttgcaatacatatcaaccaaacaagttttgaccaaaacat |
209 |
Q |
| |
|
||||| |||||| |||||||| ||||||||||||||||||||||| || |||||||||| |
|
|
| T |
19452129 |
aatttccaacgatccacattta-caatacatatcaaccaaacaagtattaaccaaaacat |
19452187 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University